Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Fix the position of first amino acid changed by the frame shift #66

Merged
merged 1 commit into from
Oct 31, 2022
Merged

Fix the position of first amino acid changed by the frame shift #66

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
1 commit
Select commit
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
fix: fix frameshift change position
  • Loading branch information
@nokara26
nokara26 committed Oct 28, 2022
commit 48a7fde390bdc2182770facc055b3fc2f4c68d86
20 changes: 9 additions & 11 deletions src/varity/vcf_to_hgvs/protein.clj
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -278,16 +278,14 @@
alt-repeat)))

(defn- protein-frame-shift
[ppos pref palt seq-info]
(let [[ppos pref palt] (if (= pref palt)
(->> (map vector (:ref-prot-seq seq-info) (:alt-prot-seq seq-info))
(drop (dec ppos))
(map-indexed vector)
(drop-while (fn [[_ [r a]]] (= r a)))
first
((fn [[i [r a]]]
[(+ ppos i) (str r) (str a)])))
[ppos pref palt])
[ppos seq-info]
(let [[ppos pref palt] (->> (map vector (:ref-prot-seq seq-info) (:alt-prot-seq seq-info))
(drop (dec ppos))
(map-indexed vector)
(drop-while (fn [[_ [r a]]] (= r a)))
first
((fn [[i [r a]]]
[(+ ppos i) (str r) (str a)])))
[_ _ offset _] (diff-bases pref palt)
alt-prot-seq (format-alt-prot-seq seq-info)
ref (nth (:ref-prot-seq seq-info) (dec (+ ppos offset)))
Expand Down Expand Up @@ -338,7 +336,7 @@
:insertion (protein-insertion ppos pref palt seq-info)
:indel (protein-indel ppos pref palt)
:repeated-seqs (protein-repeated-seqs ppos pref palt seq-info)
:frame-shift (protein-frame-shift ppos pref palt seq-info)
:frame-shift (protein-frame-shift ppos seq-info)
:extension (protein-extension ppos pref palt seq-info)
:no-effect (mut/protein-no-effect)
:unknown (mut/protein-unknown-mutation))))))
Expand Down
1 change: 1 addition & 0 deletions test/varity/vcf_to_hgvs_test.clj
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -214,6 +214,7 @@
"chr2" 47478341 "T" "TGG" '("p.L762Gfs*2" "p.L696Gfs*2")
"chr5" 112839837 "AGTGGCAT" "A" '("p.S1397Ifs*2"
"p.S1415Ifs*2") ; https://github.com/chrovis/varity/issues/58
"chr17" 31261816 "CC" "C" '("p.N1542Tfs*11" "p.N1563Tfs*11") ; cf. rs1555619041 (+)

;; frame shift with initiation codon change (e.g. NM_007298:c.-19_80del from BRCA Share)
"chr17" 43124016 "CCAGATGGGACACTCTAAGATTTTCTGCATAGCATTAATGACATTTTGTACTTCTTCAACGCGAAGAGCAGATAAATCCATTTCTTTCTGTTCCAATGAA" "C"
Expand Down